View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_85 (Length: 256)
Name: NF1379_low_85
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 5955328 - 5955102
Alignment:
| Q |
1 |
ggttgttttgtgattgagctgtttagaggagcaacagaagggtttaaggaacttggttattcaaggaacgatcctgtttttgcaatgcgcggatcgatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955328 |
ggttgttttgtgattgagctgtttagaggagcaacagaagggtttaaggaacttggttattcaaggaacgatcctgtttttgcaatgcgcggatcgatgc |
5955229 |
T |
|
| Q |
101 |
attcgattcaaagagatatgatcatgctagaaaatcagcttccccttttcatactagatttgcttctgggaattcagattggtaaaccagatttaaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5955228 |
attcgattcaaagagatatgatcatgctagaaaatcagcttccccttttcatactagatttgcttctgggaattcagattggtaaaccagatttgaaagg |
5955129 |
T |
|
| Q |
201 |
acttgttgcaaatctagcactcagatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5955128 |
acttgttgcaaatctagcactcagatt |
5955102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13042 times since January 2019
Visitors: 1278