View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1379_low_85 (Length: 256)

Name: NF1379_low_85
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1379_low_85
NF1379_low_85
[»] chr5 (1 HSPs)
chr5 (1-227)||(5955102-5955328)


Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 5955328 - 5955102
Alignment:
1 ggttgttttgtgattgagctgtttagaggagcaacagaagggtttaaggaacttggttattcaaggaacgatcctgtttttgcaatgcgcggatcgatgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5955328 ggttgttttgtgattgagctgtttagaggagcaacagaagggtttaaggaacttggttattcaaggaacgatcctgtttttgcaatgcgcggatcgatgc 5955229  T
101 attcgattcaaagagatatgatcatgctagaaaatcagcttccccttttcatactagatttgcttctgggaattcagattggtaaaccagatttaaaagg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
5955228 attcgattcaaagagatatgatcatgctagaaaatcagcttccccttttcatactagatttgcttctgggaattcagattggtaaaccagatttgaaagg 5955129  T
201 acttgttgcaaatctagcactcagatt 227  Q
    |||||||||||||||||||||||||||    
5955128 acttgttgcaaatctagcactcagatt 5955102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University