View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_86 (Length: 256)
Name: NF1379_low_86
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 5955304 - 5955553
Alignment:
| Q |
1 |
taaacagctcaatcacaaaacaaccatcaaggaccaacatttccacaaactcattgctgcttaacccgatcgttccttcataacaagatcttgctttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955304 |
taaacagctcaatcacaaaacaaccatcaaggaccaacatttccacaaactcattgctgcttaacccgatcgttccttcataacaagatcttgctttttc |
5955403 |
T |
 |
| Q |
101 |
ttccatctctttcattgcatccagataaagcctaatgtcatgttttgtcctcttaagaacgtggttaatggaacgccatttatgacgttccatttgtcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955404 |
ttccatctctttcattgcatccagataaagcctaatgtcatgttttgtcctcttaagaacgtggttaatggaacgccatttatgacgttccatttgtcga |
5955503 |
T |
 |
| Q |
201 |
aggcgttttttgccatgatggtatggtcctaaggacacaatctgtggtgc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955504 |
aggcgttttttgccatgatggtatggtcctaaggacacaatctgtggtgc |
5955553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University