View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_92 (Length: 252)
Name: NF1379_low_92
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_92 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 42035472 - 42035274
Alignment:
| Q |
1 |
ggtgtatcatctttcataaagaattaaactttgacattaagttgaatagaacagaagtcaccttatgctgtcccaataccttannnnnnnagaaaaacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
42035472 |
ggtgtatcatctttcataaagaattaaactttgacattaagttgaatagaacagaagtcgccttatgctgtcccagtaccttatttttttagaaaaacca |
42035373 |
T |
|
| Q |
101 |
atctttctctgatatggttgttgaaaataacc--tttgtcagtgtgtactgactgtactgattctttcgtttcaatgtagaagtatcaaagctacttttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42035372 |
atctttctctgatatggttgttgaaaataacctttttgtcagtg---------tgtactgattctttcgtttcaatgtagaagtatcaaagctacttttt |
42035282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University