View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_94 (Length: 252)
Name: NF1379_low_94
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_94 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 9065929 - 9066167
Alignment:
| Q |
1 |
ttaattgattttaacaaataaaagctgcatataagatgatttcttatttgggttgtttgttttttcctttactagatttatgatcggttgattgtttaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9065929 |
ttaattgattttaacaaataaaagctgcatataagatgatttcttatttgggttgtttgttttttccttgactagatttatgatcggttgattgtttaga |
9066028 |
T |
|
| Q |
101 |
atacttattctttatgaataatgttagtggcaatcatccgtaaaatctaaatcaaatgatagtatcaatattattaagttgaatattctccgtagttatt |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9066029 |
atacttattctttatcaataatgttagtggtaatcatccgtaaaatctaaatcaaatgataatatcaatattattaagttgaatattcaacgtagttatc |
9066128 |
T |
|
| Q |
201 |
taaatttgaacacaaaacatgtgaatatttaagtagtct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9066129 |
aaaatttgaacacaaaacatgtgaatatttaagtagtct |
9066167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18956 times since January 2019
Visitors: 1284