View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_99 (Length: 251)
Name: NF1379_low_99
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 42620452 - 42620215
Alignment:
| Q |
1 |
atgacagtataaagttagcatattatatatatgtatgtcaatttctgcaaattacatatacaaccactctaaatatat--gagtgatagaaagcctttag |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
42620452 |
atgacagtataaagttagcatattatat----gtatgtcaatttctgcaaattacatatacaacctctctaaatatatctgagtgatagatagcctttag |
42620357 |
T |
 |
| Q |
99 |
ctttagacttgatccaagatcaaaccttacattttagcatatccaaatgtgtacgggttaagtaacgatcattatcaaacaccacataattatgatgctt |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42620356 |
ctttagacttgatccaatatcaaaccttacattttagcatatccaaatgtgtacgagttaagtaacgatcattatcaaacaccacataattatgatgctt |
42620257 |
T |
 |
| Q |
199 |
tcaaatgaatcaaattttatgaaaaccttccttcactttctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42620256 |
tcaaatgaatcaaattttatgaaaaccttccttcactttctt |
42620215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University