View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13800_high_8 (Length: 330)

Name: NF13800_high_8
Description: NF13800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13800_high_8
NF13800_high_8
[»] chr8 (3 HSPs)
chr8 (17-330)||(12945540-12945853)
chr8 (87-193)||(12937938-12938044)
chr8 (253-327)||(12938092-12938166)


Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 17 - 330
Target Start/End: Original strand, 12945540 - 12945853
Alignment:
17 atcaaccgaggcaacaatggcaggaatttgagcagctaatgtagagcagggatggtggaaaatgagcgaggaagggtggtagaggatgaaaccaccacca 116  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
12945540 atcaacggaggcaacaatggcaggaatttgagcagctaatgtagagcaggggtggtggaaaatgagcgaggaagggtggtagaggatgaaaccaccacca 12945639  T
117 tggaagtagagaataatggggagtttggcagcagaggaagacggtggagggttcgggaggaagagacgaatggaggttttcgcagcggcgtttaagggaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12945640 tggaagtagagaataatggggagtttggcagcagaggaagacggtggagggttcgggaggaagagacgaatggaggttttcgcagcggcgtttaagggaa 12945739  T
217 tgtccttagagagagccggttgcggtggcgaattagtgggatcggaggatgatggcacggtgggcacaatgtagtttcttgttagtgaaccatcagagtt 316  Q
    |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12945740 tgtctttagagagagccggttgcagtggcgaattagtgggatcggaggatgatggcacggtgggcacaatgtagtttcttgttagtgaaccatcagagtt 12945839  T
317 gagtttgattttga 330  Q
    ||||||||||||||    
12945840 gagtttgattttga 12945853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 87 - 193
Target Start/End: Original strand, 12937938 - 12938044
Alignment:
87 gaagggtggtagaggatgaaaccaccaccatggaagtagagaataatggggagtttggcagcagaggaagacggtggagggttcgggaggaagagacgaa 186  Q
    ||||| |||||| ||| ||||||||||||||||||||||||||| |  ||||| || || || || ||||  ||||||||||| ||||||||||  || |    
12937938 gaaggatggtagcggaagaaaccaccaccatggaagtagagaatgagagggagcttagccgcggaagaaggtggtggagggtttgggaggaagatgcgga 12938037  T
187 tggaggt 193  Q
    |||||||    
12938038 tggaggt 12938044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 253 - 327
Target Start/End: Original strand, 12938092 - 12938166
Alignment:
253 tgggatcggaggatgatggcacggtgggcacaatgtagtttcttgttagtgaaccatcagagttgagtttgattt 327  Q
    ||||||||||||||| ||||||||| || ||  ||| ||||||||| || |||||||||| ||||||||||||||    
12938092 tgggatcggaggatggtggcacggtagggacgttgtcgtttcttgtgagggaaccatcagggttgagtttgattt 12938166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University