View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13800_low_9 (Length: 288)
Name: NF13800_low_9
Description: NF13800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13800_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 72 - 178
Target Start/End: Complemental strand, 2442771 - 2442665
Alignment:
| Q |
72 |
ttaaattgacattagaatatgaattcaagaaggcaccatctgagacacaattcaaagaaaacaaagtattatatagtaaaaaatatcaaaatagtcttcg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2442771 |
ttaaattgacattagaatatgaattcaagaaggcaccatctgagacacaattcaaagaaaacaaagtattatatagtaaaaaatatcaaaattgtcttcg |
2442672 |
T |
|
| Q |
172 |
tattcca |
178 |
Q |
| |
|
||||||| |
|
|
| T |
2442671 |
tattcca |
2442665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 2442632 - 2442600
Alignment:
| Q |
179 |
ctaacggtcacaaagaaccacatgtctgataaa |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
2442632 |
ctaacagtcacaaagaaccacatgtctgataaa |
2442600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University