View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13800_low_9 (Length: 288)

Name: NF13800_low_9
Description: NF13800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13800_low_9
NF13800_low_9
[»] chr3 (2 HSPs)
chr3 (72-178)||(2442665-2442771)
chr3 (179-211)||(2442600-2442632)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 72 - 178
Target Start/End: Complemental strand, 2442771 - 2442665
Alignment:
72 ttaaattgacattagaatatgaattcaagaaggcaccatctgagacacaattcaaagaaaacaaagtattatatagtaaaaaatatcaaaatagtcttcg 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
2442771 ttaaattgacattagaatatgaattcaagaaggcaccatctgagacacaattcaaagaaaacaaagtattatatagtaaaaaatatcaaaattgtcttcg 2442672  T
172 tattcca 178  Q
    |||||||    
2442671 tattcca 2442665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 2442632 - 2442600
Alignment:
179 ctaacggtcacaaagaaccacatgtctgataaa 211  Q
    ||||| |||||||||||||||||||||||||||    
2442632 ctaacagtcacaaagaaccacatgtctgataaa 2442600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University