View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_high_26 (Length: 271)
Name: NF13802_high_26
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 6 - 254
Target Start/End: Original strand, 43842707 - 43842955
Alignment:
| Q |
6 |
aggagcagagacaatcactaaaatttagcaaaatcaagcacaagagattaattgtgaaacacatggaagaaactacggagagattatcaactaagaaaga |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43842707 |
aggaacagaaacaatcactaaaatttagcaaaatcaagcacaagagattaattgtgaaacacatggaagaaactacggagagattatcaactaagaaaga |
43842806 |
T |
|
| Q |
106 |
agagaaaacaatggctttctatgtttaccatccatgctattgtcttgaagaaattttcaagacttttttgaggtgttttggtattgagtccacccaaacc |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43842807 |
agagaaaacaatgactttctatgtttaccatccatgctattgtcttgaagaaattttcaagacttttttgaggtgttttggtattgagtccacgcaaacc |
43842906 |
T |
|
| Q |
206 |
aaagaagaagaagattcatcaacatcactactcaaacctcatgcatgtg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43842907 |
aaagaagaagaagattcatcaacatcactactcaaacctcatgcatgtg |
43842955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University