View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_high_27 (Length: 267)
Name: NF13802_high_27
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 31312857 - 31312773
Alignment:
| Q |
13 |
aatatgatgaggtactacctttcttgccaaagaagaaaaatgggcactagtagaactacttattctattttttttaacataccaa |
97 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31312857 |
aatataatgaggtactagctttcgtgccaaagaagaaaaatgggcactagtagagctacttattctattttttttaacataccaa |
31312773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 195 - 250
Target Start/End: Complemental strand, 31312677 - 31312622
Alignment:
| Q |
195 |
tatattatcccaccccaaacttaagatgttaattccaaagaacaacaccaaattta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31312677 |
tatattatcccaccccaaacttaagatgttaattccaaagaacaaccccaaattta |
31312622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 12023366 - 12023426
Alignment:
| Q |
13 |
aatatgatgaggtactacctttcttgccaaagaagaaaaatgggcactagtagaactactt |
73 |
Q |
| |
|
||||||||||||||| | |||| ||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
12023366 |
aatatgatgaggtaccagcttttatgccaaacaagaaaaatggttactactagaactactt |
12023426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 250
Target Start/End: Original strand, 25923383 - 25923437
Alignment:
| Q |
199 |
ttatcccaccccaaacttaagatgt---taattccaaagaacaacaccaaattta |
250 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
25923383 |
ttatcccaccccaaacttaagatgttgctaattccaaagagtaaccccaaattta |
25923437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University