View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_high_35 (Length: 229)
Name: NF13802_high_35
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 106 - 215
Target Start/End: Complemental strand, 56189441 - 56189332
Alignment:
| Q |
106 |
ctattgttcagcctccgcccatccccttcgccttgtaattagtgggaaaggtttgatttttgtatactttacacaaaggaattgtagagtggattcttgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56189441 |
ctattgttcagcctccgcccatccccttcgccttgtaattagtgggaaaggtttgatttttgtatactttacacaaaggaattgtagagtggattcttgg |
56189342 |
T |
 |
| Q |
206 |
tttgcctttg |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
56189341 |
tttgcctttg |
56189332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 56189611 - 56189505
Alignment:
| Q |
1 |
tccccaaatggaggaccaagcctgagactgtgagattgcaatttgaggtgctggcaaaagtggatggtgataaagtcatccctgagagagtcgtgcaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56189611 |
tccccaaatggaggaccaagcctgagactgtgagattgcaatttgaggtgctggcaaaagtggatggtgataaagtcatacctgagagagtcgtgcaagt |
56189512 |
T |
 |
| Q |
101 |
gaaccct |
107 |
Q |
| |
|
||||||| |
|
|
| T |
56189511 |
gaaccct |
56189505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 7 - 112
Target Start/End: Original strand, 2391654 - 2391759
Alignment:
| Q |
7 |
aatggaggaccaagcctgagactgtgagattgcaatttgaggtgctggcaaaagtggatggtgataaagtcatccctgagagagtcgtgcaagtgaaccc |
106 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2391654 |
aatggaggactaagcctgacactgtgaggttgcattttgaggtgctggctaaagttgatggtgataaagtcatacctgagagagtcatgcaagtgaaccc |
2391753 |
T |
 |
| Q |
107 |
tattgt |
112 |
Q |
| |
|
| |||| |
|
|
| T |
2391754 |
tgttgt |
2391759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 111 - 215
Target Start/End: Original strand, 2391824 - 2391930
Alignment:
| Q |
111 |
gttcagcctccgcccatccccttcgccttgt-aattagtgggaaaggtttgatttttgtatactttacac-aaaggaattgtagagtggattcttggttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||| || ||||||||||||||| ||||||| | ||||||||||||||| ||||||| | || |
|
|
| T |
2391824 |
gttcagcctccgcccatccccttcgccttgtaaatcagtggcaagggtttgatttttgtaaactttactcaaaaggaattgtagaggggattctcgtctt |
2391923 |
T |
 |
| Q |
209 |
gcctttg |
215 |
Q |
| |
|
||||||| |
|
|
| T |
2391924 |
gcctttg |
2391930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University