View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_high_36 (Length: 227)
Name: NF13802_high_36
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 98 - 211
Target Start/End: Complemental strand, 25814926 - 25814813
Alignment:
| Q |
98 |
gacccattccatcatttcttcttctttctacactttatcttctttcatttgatagaagtttggagttagtattagtggattatccacccttaaaggttgc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814926 |
gacccattccatcatttcttcttctttctacactttatcttctttcatttgatagaagtttggagttagtattagtggattatccacccttaaaggttgc |
25814827 |
T |
|
| Q |
198 |
tcattaagattcat |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25814826 |
tcattaagattcat |
25814813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 4 - 60
Target Start/End: Complemental strand, 25815639 - 25815583
Alignment:
| Q |
4 |
atatttagtgtgtgtacttcaaacatgacaactttacttgaaacaaaactctaaaaa |
60 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25815639 |
atatttagtgtgcgtacttcaaacatgacaactttacttgaaacaaaactctaaaaa |
25815583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University