View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_14 (Length: 400)
Name: NF13802_low_14
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 12 - 387
Target Start/End: Complemental strand, 50301411 - 50301036
Alignment:
| Q |
12 |
atgaagtcaaagtttctaaatttggttgctttttatggtgatagagtgcatcccggagtaggagaagtggcggaggcagcagtgaaatggtggcggcggc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50301411 |
atgaagtcaaagtttctaaatttggttgttttttatggtgatagagtgcatcccggagtaggagaagtggcggcggcagcagtgaaatggtggcggcggc |
50301312 |
T |
 |
| Q |
112 |
agaacaatcgcggcggtggcatgatgttttctggttaggaatatttgtcattcatttgattgcactgggattccttttgggggttcttggtctcaacagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301311 |
agaacaatcgcggcggtggcatgatgttttctggttaggaatatttgtcattcatttgattgcactgggattccttttgggggttcttggtctcaacagg |
50301212 |
T |
 |
| Q |
212 |
tttgagaaagagaatagactgaacattgataagtacactcctggtcttactgggaatcatgccgggttaaccgaaacttattggccgctttatgcggctg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301211 |
tttgagaaagagaatagactgaacattgataagtacactcctggtcttactgggaatcatgccgggttaaccgaaacttattggccgctttatgcggctg |
50301112 |
T |
 |
| Q |
312 |
ctggtggaattgggactgttcttggatggacttggttgttgttgttgggttcccaggctactcaaatgatgaaagt |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301111 |
ctggtggaattgggactgttcttggatggacttggttgttgttgttgggttcccaggctactcaaatgatgaaagt |
50301036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University