View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_22 (Length: 332)
Name: NF13802_low_22
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 106 - 316
Target Start/End: Complemental strand, 13969001 - 13968791
Alignment:
| Q |
106 |
gttattatgattctaccggcgtgcgagggaagatatcagcaagcaatttcttgtaacgtttaataggatgtcttgatctttcccgcaatgcaggacaaaa |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13969001 |
gttattattattctaccggcgtgcgagggaagatatcagcaagcaatttcttgtaacgtttaataggatgtcttgatctttcccgcaatgcaggacaaaa |
13968902 |
T |
 |
| Q |
206 |
acaacataaactaccgcaaacaggccaaatgttacgcgaaataacgctcattttcttcgaattatgaatgtaaatgtaatattacaatatcaaattgata |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13968901 |
acaacataaactaccgcaaacaggccaaatgttacgcgaaataacgctcattttcttcgaattatgaatgtaaatgtaatattacaatatcaaattgata |
13968802 |
T |
 |
| Q |
306 |
tatttttatga |
316 |
Q |
| |
|
||||||||||| |
|
|
| T |
13968801 |
tatttttatga |
13968791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University