View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_23 (Length: 323)
Name: NF13802_low_23
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 74 - 299
Target Start/End: Original strand, 44882694 - 44882937
Alignment:
| Q |
74 |
gaacctcttgctggaaataatgatcgtggagaagacggaaaactggatttgcttagcaaaagaatagagaagaaaaggtct------------------a |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44882694 |
gaacctcttgctggaaataatgatcgtggagaagatggaaaactggatttgcttagcaaaagaatagagaagaaaaggtctcatttgaagcaagtgtcta |
44882793 |
T |
|
| Q |
156 |
aggagctgaagcgtaaagttggagctgnnnnnnnggagtatgataggactacgtctgcagctgctaatgctctcaaaggactcaactttatcaccaaagc |
255 |
Q |
| |
|
||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44882794 |
aggagctgaagcgtaaagttggaactgaaaaaaagaagtatgataggactacgtctgcagcttctaatgctctcaaaggacttaactttatcaccaaagc |
44882893 |
T |
|
| Q |
256 |
tgctcgtgatgatggatgggaaaaggtttgtggggagttttata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44882894 |
tgctcgtgatgatggatgggaaaaggtttatggggagttttata |
44882937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 44882594 - 44882646
Alignment:
| Q |
1 |
cagaagtaaagttaagataagctcgaaggaacaagatgaagaagaaaatgaat |
53 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44882594 |
cagaagaaaagttaagataagctcgaaggaacaaaatgaagaagaaaatgaat |
44882646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 248
Target Start/End: Original strand, 44913020 - 44913074
Alignment:
| Q |
194 |
tatgataggactacgtctgcagctgctaatgctctcaaaggactcaactttatca |
248 |
Q |
| |
|
||||||||||||| |||||||||| || ||||||| | ||||||||| ||||||| |
|
|
| T |
44913020 |
tatgataggactaagtctgcagcttctcatgctcttagaggactcaagtttatca |
44913074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University