View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_24 (Length: 303)
Name: NF13802_low_24
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 8931758 - 8931612
Alignment:
| Q |
18 |
ctaatgtttagcgtgtgcgggtttctc-------tttaagttgtgttgtatgctgataaagcttaagcaggagaaatgcaacagcaagccttgtagagta |
110 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931758 |
ctaatgtttggcgtgtgcgggtttctcctgatattttaagttgtcttgtatgctgataaagcttaagcaggagaaatgcaacagcaagccttgtagagta |
8931659 |
T |
 |
| Q |
111 |
ccttagtgctgaatcgctttctcatctcaaaagctggcgtgccatcc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931658 |
ccttagtgctgaatcgctttctcatctcaaaagctggcgtgccatcc |
8931612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 243 - 291
Target Start/End: Complemental strand, 8931526 - 8931478
Alignment:
| Q |
243 |
ggaatgaattgtttctctcgttgagtggagaagcatttagtatgatgat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931526 |
ggaatgaattgtttctctcgttgagtggagaagcatttagtatgatgat |
8931478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University