View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_27 (Length: 273)
Name: NF13802_low_27
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 13111935 - 13112183
Alignment:
| Q |
18 |
gttatttactcactaaacatgatcatcagagaaattaggttcatgaggtttaaaaaactgtggcacaggatcactttcttgaatcttatcattccctttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13111935 |
gttatttactcactaaacatgatcatcagagaaattaggttcatgaggtttaaacaactgtggcacagggtcactttcttgaatcttatcattccctttc |
13112034 |
T |
 |
| Q |
118 |
tttgtatttgcagcaaatcttgaagccaaaacagtagcaccaaaattattaaaacttttaccactcattgatgtttcttcaatctcaggatcaaccatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13112035 |
tttgtatttgcagcaaatcttgaagccaaaacagtagcaccaaaattattaaaacttttaccactccttgatgtttcttcaatctcaggatcaaccatgt |
13112134 |
T |
 |
| Q |
218 |
aataaagcccttctttaattgacaactctcttgttgcctttcttctctg |
266 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13112135 |
aataaagtccttctttaattgacaactctcttgttgcctttcttttctg |
13112183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 162
Target Start/End: Complemental strand, 40678755 - 40678705
Alignment:
| Q |
112 |
cctttctttgtatttgcagcaaatcttgaagccaaaacagtagcaccaaaa |
162 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
40678755 |
cctttcttagtgtttgcagcaaattttgaagccaaaaatgtagcaccaaaa |
40678705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University