View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_33 (Length: 245)
Name: NF13802_low_33
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_33 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 29215166 - 29214938
Alignment:
| Q |
16 |
ttatggccatttattttagtcttcatgagtgcatgtctctctcttgctgtggaaatgaaaatgactctctccaactgttccacgttcaataagatgaacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29215166 |
ttatggccatttattttagtcttcatgagtgcatgtctctctcttgctgtggaaatgaaaatgactctctccaactgttccacgttcaataagatgaacc |
29215067 |
T |
 |
| Q |
116 |
ttcaacttcatatttaaggaaggaaaatatgtataaattattctatagaagaaattgaaatacaataccaacatgggttgacacatatggtcaaagattg |
215 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29215066 |
ttcaatttcatattcaaggaaggaaaatatgtat-aagtattctatagtagaaattgaaatacaataccaacatgggttgacacatatggtcaaagattg |
29214968 |
T |
 |
| Q |
216 |
agagttaaactcaaatttagtatgttcgac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29214967 |
agagttaaactcaaatttagtatgttcgac |
29214938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University