View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_34 (Length: 240)
Name: NF13802_low_34
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 27751446 - 27751667
Alignment:
| Q |
19 |
agggtaagtctacaaggaagaatagtagaacctcttgcaggaatcaaaccagcatatatatctgtatctccaacttcaacacctttatacatcaaaagac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27751446 |
agggtaagtctacaaggaagaatagtagaaccttttgcaggaatcaaaccagcatatatatctgtatctccaacttcaacacctttatacatcaaaagac |
27751545 |
T |
 |
| Q |
119 |
tagttccatctgcatgtttgaagcttgcatggttttgattatcaacttgaatcttgagatttagagtaacattgagttgtatgttaatagcaggaaatgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27751546 |
tagttccatctgcatgtttgaagcttgcatggttttgattatcgacttgaatcttgagatttagagtaacattgagttgtatgttaatagcaggaaatgt |
27751645 |
T |
 |
| Q |
219 |
tagacgaggtgatataccttct |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27751646 |
tagacgaggtgatataccttct |
27751667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University