View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_37 (Length: 232)
Name: NF13802_low_37
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 179
Target Start/End: Original strand, 32865696 - 32865858
Alignment:
| Q |
17 |
attgttgatcactcaaaatgataaataaggatttcattttcatgcttggatgtcactgtaatgtctatgttaaggcagcacatgtggcttgacaagtgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32865696 |
attgttgatcactcaaaatgataaataaggatttcattttcatgcttggatgtcactgtaatgtctatgttaaggcagcacatgtggcctgacaagtgta |
32865795 |
T |
 |
| Q |
117 |
tggataatcaaagtacaatgattgtctcatcgaacaaacatgaaacatgtgatttttccctcc |
179 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32865796 |
tggataatcatagtacaatgattgtctcatcgaacaaacatgaaacatgtgatttttccctcc |
32865858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University