View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13802_low_38 (Length: 229)
Name: NF13802_low_38
Description: NF13802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13802_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 22574264 - 22574050
Alignment:
| Q |
1 |
cacaaatgtgatttgtgtggcagagaattcaccactggtaacgccctcggcggccacaaagcattccataacggcaacaactttcttctagggaaaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22574264 |
cacaaatgtgatttgtgtggcagagaattcaccactggtaacgccctcggcggccacaaagcattccataacggcaacaactttcttctagggaaaataa |
22574165 |
T |
|
| Q |
101 |
acaaacaaaaacatgctgatggtattaagatcgaaaccaaccattcatgtgttcgttgcagcaagactttttcatgtgtcaatgctctgaacggacatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22574164 |
acaaacaaaaacatgctgatggtattaagatcgaaaccagccattcatgtgttcgttgcagcaagactttttcatgtgtcaatgctctgaacggacatat |
22574065 |
T |
|
| Q |
201 |
gaaattgcacagcca |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22574064 |
gaaattgcacagcca |
22574050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 175
Target Start/End: Complemental strand, 22564570 - 22564533
Alignment:
| Q |
138 |
caaccattcatgtgttcgttgcagcaagactttttcat |
175 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
22564570 |
caaccattcatgtgttctttgcagcaaggctttttcat |
22564533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 27301106 - 27301037
Alignment:
| Q |
1 |
cacaaatgtgatttgtgtggcagagaattcaccactggtaacgccctcggcggccacaaagcattccata |
70 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
27301106 |
cacaaatgtgatttgtgtgacagagaattcacaactggtgatgccctcggcggccacaaagcattccata |
27301037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University