View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13804_high_5 (Length: 215)

Name: NF13804_high_5
Description: NF13804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13804_high_5
NF13804_high_5
[»] chr2 (1 HSPs)
chr2 (19-199)||(1251155-1251336)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 1251155 - 1251336
Alignment:
19 ataaagtatgattcatgatggtatnnnnnnn-tgtatgattcgtgtttatttaaacttagatacaagataccatattgaagatgcagagatgcatgagag 117  Q
    ||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||    
1251155 ataaagtatgattcatgatggtataaaaaaaatgtatgattcgtgtttatttaaacttagatacagtataccatattgaagatgcagagatgcatgagag 1251254  T
118 agtaataaattgaagtgttgcaactaaagagttttgtggcaatataaacgaatagtgcaatgaaaaagtgtaataccctttg 199  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
1251255 agtaataaattgaagtgttgcaactaaagagttttgtagcaatataaacgaatagtgcaatgaaaaagtgtaataccctttg 1251336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University