View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13804_low_5 (Length: 215)
Name: NF13804_low_5
Description: NF13804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13804_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 1251155 - 1251336
Alignment:
| Q |
19 |
ataaagtatgattcatgatggtatnnnnnnn-tgtatgattcgtgtttatttaaacttagatacaagataccatattgaagatgcagagatgcatgagag |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1251155 |
ataaagtatgattcatgatggtataaaaaaaatgtatgattcgtgtttatttaaacttagatacagtataccatattgaagatgcagagatgcatgagag |
1251254 |
T |
 |
| Q |
118 |
agtaataaattgaagtgttgcaactaaagagttttgtggcaatataaacgaatagtgcaatgaaaaagtgtaataccctttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251255 |
agtaataaattgaagtgttgcaactaaagagttttgtagcaatataaacgaatagtgcaatgaaaaagtgtaataccctttg |
1251336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University