View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13805_high_17 (Length: 255)
Name: NF13805_high_17
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13805_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 228528 - 228752
Alignment:
| Q |
19 |
acctggctttaaagattaatatctctaaagcatttgatacccttgattggagctttcttctttcagttctcaagtgttttggttttaatgaaattttttg |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
228528 |
acctggctttaaagattgatatctctaaagcatttgatacccttgattggagctttcttctttcagttctcaagtgtcttggttttaatgaaattttttg |
228627 |
T |
 |
| Q |
119 |
caaatggatagaggtgattcttaactctgcaactctttcaatcaatattaatggcggtcaagagggttatttccattgcaagagaggggtgaggcagggg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
228628 |
caaatggatagaggtgattcttaactctgcaactctttcaatcaatattaatggcagtcaatagggttatttccattgcaagagaggggtgaggcagggg |
228727 |
T |
 |
| Q |
219 |
gaccccctctctccccttttatttt |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
228728 |
gaccccctctctccccttttatttt |
228752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 90 - 127
Target Start/End: Complemental strand, 28337486 - 28337449
Alignment:
| Q |
90 |
aagtgttttggttttaatgaaattttttgcaaatggat |
127 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28337486 |
aagtgttttggttttaatgatattttttgcaaatggat |
28337449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University