View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13805_high_18 (Length: 240)
Name: NF13805_high_18
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13805_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 20505628 - 20505550
Alignment:
| Q |
1 |
attttgatgattcaacacaatcaggcttctttgtgaactcaatctcaattggtctacccgtcaagatctcatcgctttc |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20505628 |
attttgatgattcaacacaatcaggcttctttgtgaactcaatctcgattggtctacccgtcaagatctcatcgctttc |
20505550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 20475824 - 20475758
Alignment:
| Q |
1 |
attttgatgattcaacacaatcaggcttctttgtgaactcaatctcaattggtctacccgtcaagat |
67 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| || ||||||||| |||| || ||||| |
|
|
| T |
20475824 |
attttgatgattcaacgcaattaggcttctttgtgaactcgatatcaattggtgtaccagtgaagat |
20475758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 2917075 - 2917028
Alignment:
| Q |
1 |
attttgatgattcaacacaatcaggcttctttgtgaactcaatctcaa |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
2917075 |
attttgatgattcagcacaatcaggcttcttagtaaactcaatctcaa |
2917028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University