View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13805_high_22 (Length: 216)
Name: NF13805_high_22
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13805_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 46764561 - 46764363
Alignment:
| Q |
1 |
tcccaccatttgcttacttgcaacgaggcagtaccttgaatgtcctggcatgctatatccatcttcattagaggcagatccaccattagtggacattggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46764561 |
tcccaccatttgcttacttgcaacgaggcagtaccttgaatgtcctggcatgctatatccatcttcattagaggcagatccaccattagtggacattggt |
46764462 |
T |
 |
| Q |
101 |
gaatataagactgtactcggtgaatccacaaggccattgtcatcatcagacgatccccatcttgaatagtcactcggtctcgagtagtcacttgccctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46764461 |
gaatataagactgtactcggtgaatccacaaggccattgtcatcatcagacgatccccatcttgaatagtcactcggtctcgagtagtcacttgccctt |
46764363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 5 - 199
Target Start/End: Complemental strand, 1085031 - 1084837
Alignment:
| Q |
5 |
accatttgcttacttgcaacgaggcagtaccttgaatgtcctggcatgctatatccatcttcattagaggcaga---tccaccattagtggacattggtg |
101 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||| | || |||||||| |||||||||||| || |||| ||| |||| || ||||||||| |
|
|
| T |
1085031 |
accatttgtttacttgcaacaaggctgtaccttgagcgccccggcatgctgtatccatcttcacccgatgcagcaggtcctccataag---acattggtg |
1084935 |
T |
 |
| Q |
102 |
aatataagactgtactcggtgaatccacaaggccattgtcatcatcagacgatccccatcttgaatagtcactcggtctcgagtagtcacttgccctt |
199 |
Q |
| |
|
|| | | |||||||||||| ||||| | |||||||||||||| ||||| || |||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
1084934 |
aaaacaggactgtactcggagaatcttcgaggccattgtcatcttcagatgaaccccatcttgaatagtcacttggtcgagagtagtcgcttgccctt |
1084837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University