View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13805_high_4 (Length: 468)
Name: NF13805_high_4
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13805_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 451
Target Start/End: Complemental strand, 7751195 - 7750762
Alignment:
| Q |
18 |
ctctctatatctgctcaagcatgcaaccacaacgacaaaaatgttctcctagagatcaaatcccattttggaaacaatgcttccgtctttaccacctggg |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
7751195 |
ctctttatatctgctcaagcatgcaaccataatgacaaaaatgttctcctagagatcaaatcccatttcggaaacaatgcttccgtctttaccacgtggg |
7751096 |
T |
 |
| Q |
118 |
atcctaacacgaactgctgccagaactggacaggcatcacgtgtgacacgaatggccgtgtcaattcgcttgtagtcattaatgcggatgacatcaacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7751095 |
atcctaacacgaactgctgccagaactggacaggcatcgcgtgtgacacgaatggtcgtgtcaattcgcttatagtcattaatgcggatgacatcaacaa |
7750996 |
T |
 |
| Q |
218 |
cgaattcccatcctcggtaggaaatctcccatttcttcaagttctccaattctccgctttaccccatgtgtctggtgaaatcccttcatccctcgcgaag |
317 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750995 |
cgaatttccatcctcggtaggaaatctcccatttcttcaagttctccaattctccgctttaccccatgtgtctggtgaaatcccttcatccctcgcgaag |
7750896 |
T |
 |
| Q |
318 |
ttaaccaaccttttgcacctcgacctcagcctaaataacctcacaggcccaattcctagttttcttgccctactcaagggcctaactttcattgacttct |
417 |
Q |
| |
|
||| |||||||| | || ||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| ||| ||| || ||||||| |
|
|
| T |
7750895 |
ttatccaaccttgtccatctcgacctcagcctaaacaaccttacaggcccaattcctagttttctaaccctactcaagggcgtaaattttatcgacttct |
7750796 |
T |
 |
| Q |
418 |
cttccaacagcctttccggcccaattccatcatc |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7750795 |
cttccaacagcctttccggcccaattccatcatc |
7750762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University