View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13805_low_17 (Length: 287)
Name: NF13805_low_17
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13805_low_17 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 154 - 287
Target Start/End: Original strand, 7382008 - 7382141
Alignment:
| Q |
154 |
tctgatatccaacccaatgaccgactaatccgagtagttcaatttcaccatccacttgcaaaggtccatttaaagttggattgaaacactatatagacaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||||||||| |||||||||||||||| | |
|
|
| T |
7382008 |
tctgatatccaacccaatgaccgactaatccgagtagttcaatttcaccgttcacttgcaaaggtctattaaaagttggatcgaaacactatatagacta |
7382107 |
T |
|
| Q |
254 |
acccatcaaaattgatattagatgaaatcaaacc |
287 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||| |
|
|
| T |
7382108 |
acacatcaaaattgatatcagatgaaatcaaacc |
7382141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 73 - 132
Target Start/End: Original strand, 7381919 - 7381978
Alignment:
| Q |
73 |
tttctagtaggcaaaattgaaaacaagaaaaactttatttcttttccgtagatatagatt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381919 |
tttctagtaggcaaaattgaaaacaagaaaaactttatttcttttccgtagatatagatt |
7381978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 69
Target Start/End: Original strand, 7381737 - 7381796
Alignment:
| Q |
10 |
aaaatattcatagtagtaaaagttttttggaattgnnnnnnncttctgaaaaattgagct |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7381737 |
aaaatattcatagtagtaaaagttttttggaattgaaaaaaacttctgaaaaattgagct |
7381796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 39714659 - 39714711
Alignment:
| Q |
159 |
tatccaacccaatgaccgactaatccgagtagttcaatttcaccatccacttg |
211 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
39714659 |
tatccagcccaaggaccgactaatccgaggagtccaatcccaccatccacttg |
39714711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University