View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13805_low_20 (Length: 255)
Name: NF13805_low_20
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13805_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 239
Target Start/End: Original strand, 4885133 - 4885364
Alignment:
| Q |
8 |
gattattcttatccggtggtggcggtgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttagg |
107 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885133 |
gattatttttatccggtggtggcggcgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttagg |
4885232 |
T |
|
| Q |
108 |
aacaactccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatt |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885233 |
aacaacaccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatt |
4885332 |
T |
|
| Q |
208 |
tcttctactcgaccgttgcagtgtactatacg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4885333 |
tcttctactcgaccgttgcagtgtactatacg |
4885364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University