View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13805_low_22 (Length: 240)

Name: NF13805_low_22
Description: NF13805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13805_low_22
NF13805_low_22
[»] chr6 (3 HSPs)
chr6 (1-79)||(20505550-20505628)
chr6 (1-67)||(20475758-20475824)
chr6 (1-48)||(2917028-2917075)


Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 20505628 - 20505550
Alignment:
1 attttgatgattcaacacaatcaggcttctttgtgaactcaatctcaattggtctacccgtcaagatctcatcgctttc 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
20505628 attttgatgattcaacacaatcaggcttctttgtgaactcaatctcgattggtctacccgtcaagatctcatcgctttc 20505550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 20475824 - 20475758
Alignment:
1 attttgatgattcaacacaatcaggcttctttgtgaactcaatctcaattggtctacccgtcaagat 67  Q
    |||||||||||||||| |||| |||||||||||||||||| || ||||||||| |||| || |||||    
20475824 attttgatgattcaacgcaattaggcttctttgtgaactcgatatcaattggtgtaccagtgaagat 20475758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 2917075 - 2917028
Alignment:
1 attttgatgattcaacacaatcaggcttctttgtgaactcaatctcaa 48  Q
    |||||||||||||| |||||||||||||||| || |||||||||||||    
2917075 attttgatgattcagcacaatcaggcttcttagtaaactcaatctcaa 2917028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University