View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13807_high_2 (Length: 419)
Name: NF13807_high_2
Description: NF13807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13807_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 11680990 - 11681253
Alignment:
| Q |
18 |
atgattctcttagttaagggtcaatctcatcacaccactgaactcattgattcaaactgagtatttgttggatggtgtccttaaaagaaattggaaaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11680990 |
atgattctcttagttaagggtcaatctcatcacaccactgaactcattgattcaaactgagtatttgttggatggtgtccttaaaagaaattggaaaaag |
11681089 |
T |
|
| Q |
118 |
gctattggcttatttcgcatgcggctatatgaaaggcgcgaaatggaatgatttttcttatgataaggggatagatgttgaggaattgatggaagaggtc |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11681090 |
gctattggcttatttggcatgcggctatatgaaaggcgcgaaatggaatgattttt-ttatgataaggggatagatgttgaggaattgatggaagaggtc |
11681188 |
T |
|
| Q |
218 |
aaagtcctttcctggaaatggagttgtctaggttgaagtcttctctatgtatgttctacgagatg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11681189 |
aaagtcctttcctggaaatggagttgtctaggttgaagtcttctctatgtatgttctacgagatg |
11681253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 293 - 397
Target Start/End: Original strand, 11681305 - 11681409
Alignment:
| Q |
293 |
agtcgtagctttgtgttttggttcagctgtctctgaagggtgcatggaccttttgctgagatgctgcggtttgtgctggttttgctggggttttcactgt |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
11681305 |
agtcgtagctttgtgttttggttcagctgtctctgaagggtgcatggaccttttgctgtgatgctgcggtttgtgctagttttgctgggtttttgactgt |
11681404 |
T |
|
| Q |
393 |
ttgtc |
397 |
Q |
| |
|
||||| |
|
|
| T |
11681405 |
ttgtc |
11681409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University