View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13808_high_37 (Length: 268)
Name: NF13808_high_37
Description: NF13808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13808_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 35917211 - 35917449
Alignment:
| Q |
18 |
gtaactgcctcgcagtaaacctgttgacatgaaataaaattgactaagcatttcactagagagnnnnnnn-ctttgtacaaacataaatttattagtctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35917211 |
gtaactgcctcgcagtaaacctgttgacatgaaataaa-ttgactaagcatttcaatagagagaaaaaaaactttgtacaaacataaatttattagtctt |
35917309 |
T |
 |
| Q |
117 |
tcaatttttcacattgaacattccattgtaacagtacagtttttctaaaagaagggtaagtaattgtactcacttcatgtttgtttgtgtcaactccagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35917310 |
tcaatttttcacattgaacattccattgtaacagtacagtttttctaaaagaagggtaagtaattgtactcacttcatgtttgtttgtgtcgactccagt |
35917409 |
T |
 |
| Q |
217 |
gcaggaagctagaaagaagtatgagttgggttcctttgct |
256 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35917410 |
gcaggaagctaaaaagaagtatgagttgggttcctttgct |
35917449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University