View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13808_high_42 (Length: 242)
Name: NF13808_high_42
Description: NF13808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13808_high_42 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 3 - 242
Target Start/End: Complemental strand, 53677700 - 53677461
Alignment:
| Q |
3 |
atcaaagtactattataaatgtgatttcattttgcataggattcctgtgattggtggtaaggagcttgatttgcacgttctctacgtggaagttacaagg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53677700 |
atcaaagtactattataaatgtgatttcattttgcataggattcctgtgattggtggtaaggagcttgatttgcacgttctctacgtggaagttacaagg |
53677601 |
T |
|
| Q |
103 |
agaagtggttatgagaaggtggattctctcccttcgttataagattaaactgttttatactattttttgcactataaattagataatagttaataatttt |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53677600 |
agaagcggttatgagaaggtggattctctcccttcgttataagattaaactgttttatactattttttgcactataaattagataatagttaataatttt |
53677501 |
T |
|
| Q |
203 |
caaatttcaggttgttgcagagaagaaatggagagaagta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53677500 |
caaatttcaggttgttgcagagaagaaatggagagaagta |
53677461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University