View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13808_high_43 (Length: 239)
Name: NF13808_high_43
Description: NF13808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13808_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 16 - 158
Target Start/End: Complemental strand, 1077309 - 1077169
Alignment:
| Q |
16 |
tcaatgatgaagaataaaaattgtatgtgttgttggaattctttttgttaaggtattcaataacgaaaaagaaataccgcatttgttagacgatgacctt |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||| |
|
|
| T |
1077309 |
tcaatgatgaagaataaaa-ttgtatgtgttgttggaattctttttgttaaggtattcaataacgaaaa-gaaaaaccgcatttgttagacgatgatctt |
1077212 |
T |
|
| Q |
116 |
tataaattacaatactcaagctcactacttctctcatattttg |
158 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
1077211 |
tataaattacaatactcaagctcgctccttctctcatattttg |
1077169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 192 - 223
Target Start/End: Complemental strand, 1077173 - 1077142
Alignment:
| Q |
192 |
ttttggtagtagtttgagcaaatcatgtctat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1077173 |
ttttggtagtagtttgagcaaatcatgtctat |
1077142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 1727770 - 1727680
Alignment:
| Q |
129 |
actcaagctcactacttctctcatattttgtagtcatattatttttacctactttctacacttttttggtagtagtttgagcaaatcatgtc |
220 |
Q |
| |
|
||||||||||||||||| ||| |||||| ||||||| | | |||| | ||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
1727770 |
actcaagctcactacttatcttgtattttatagtcatcct-tctttatgtgctttctacactttatttgtagtaatttgagcaaatcatgtc |
1727680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University