View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13808_low_47 (Length: 242)

Name: NF13808_low_47
Description: NF13808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13808_low_47
NF13808_low_47
[»] chr3 (1 HSPs)
chr3 (3-242)||(53677461-53677700)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 3 - 242
Target Start/End: Complemental strand, 53677700 - 53677461
Alignment:
3 atcaaagtactattataaatgtgatttcattttgcataggattcctgtgattggtggtaaggagcttgatttgcacgttctctacgtggaagttacaagg 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53677700 atcaaagtactattataaatgtgatttcattttgcataggattcctgtgattggtggtaaggagcttgatttgcacgttctctacgtggaagttacaagg 53677601  T
103 agaagtggttatgagaaggtggattctctcccttcgttataagattaaactgttttatactattttttgcactataaattagataatagttaataatttt 202  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53677600 agaagcggttatgagaaggtggattctctcccttcgttataagattaaactgttttatactattttttgcactataaattagataatagttaataatttt 53677501  T
203 caaatttcaggttgttgcagagaagaaatggagagaagta 242  Q
    ||||||||||||||||||||||||||||||||||||||||    
53677500 caaatttcaggttgttgcagagaagaaatggagagaagta 53677461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University