View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13808_low_49 (Length: 234)
Name: NF13808_low_49
Description: NF13808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13808_low_49 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 26 - 234
Target Start/End: Complemental strand, 2893006 - 2892798
Alignment:
| Q |
26 |
aaataaataacgttgaattttttatttagggaaaataatgttgaacttgtaaataaataacgttgatctttgaaagattaaccaaaggaatcgaggaagg |
125 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2893006 |
aaataaataacgttgaattttttttttagggaaaataacgttgaacttgtaaataaataacgttgatctttgaaagattaaccaaaggaatcgaggaagg |
2892907 |
T |
|
| Q |
126 |
aaattttgaccatagttataaccagcttttccacaatcacggctcaaaacctcgtttaattaacgtgacctattttgctaagctaccatagtacattata |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892906 |
aaattttgaccatagttataaccagcttttccacaatcacggctcaaaacctcgtttaattaacgtgacctattttgctaagctaccatagtacattata |
2892807 |
T |
|
| Q |
226 |
ttattaaac |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
2892806 |
ttattaaac |
2892798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University