View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13808_low_52 (Length: 216)
Name: NF13808_low_52
Description: NF13808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13808_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 68 - 197
Target Start/End: Original strand, 3706062 - 3706191
Alignment:
| Q |
68 |
aaacaaagctacattcctttgtagcaaattcaatctggactcgccattaatctggcgagccccagcagtgacgatgcagaggtcagaccccatcgtcact |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
3706062 |
aaacaaagctacattcctttgtagcaaattcaatctggactcgccattaatctgacgagccccagcagtgacgatgcagaggtcggaacccatcgtcact |
3706161 |
T |
 |
| Q |
168 |
gaatagtcagtggaggcctggatcttagtg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3706162 |
gaatagtcagtggaggcctggatcttagtg |
3706191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University