View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13809_high_10 (Length: 246)
Name: NF13809_high_10
Description: NF13809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13809_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 88 - 163
Target Start/End: Complemental strand, 673184 - 673109
Alignment:
| Q |
88 |
ctttttgtggacacaaaattagcattgaagtttcatgtgtcacattttaccatattttcttaaaatgagttcattt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
673184 |
ctttttgtggacacaaaattagcattgaagtttcatgtgtcacattttaccatattttcttaaaatgagttcattt |
673109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 171 - 244
Target Start/End: Complemental strand, 672892 - 672819
Alignment:
| Q |
171 |
ttgcagcttctgataactgcttcaatgatggctctattgcacttcctacctagttttttgactcctatgctgat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
672892 |
ttgcagcttctgataactgcttcaatgatggctctattgcacttcctacctagttttttgactcctatcctgat |
672819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University