View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13809_high_11 (Length: 245)

Name: NF13809_high_11
Description: NF13809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13809_high_11
NF13809_high_11
[»] chr4 (1 HSPs)
chr4 (122-228)||(37790967-37791073)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 122 - 228
Target Start/End: Original strand, 37790967 - 37791073
Alignment:
122 cattggtcgtgtaaaactattttacactccaatgaattcacactatgatgccactttttagactagtgcctaaagtttcttaacaaatatctattttatg 221  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||  ||    
37790967 cattggtcgtgtaaaactattttacactccaatgaattcacactgtggtgccactttttagactagtgcctaaagtttcttaacaaatatctatttgttg 37791066  T
222 taatttt 228  Q
    |||||||    
37791067 taatttt 37791073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University