View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13809_high_12 (Length: 243)
Name: NF13809_high_12
Description: NF13809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13809_high_12 |
 |  |
|
| [»] scaffold0380 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0380 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: scaffold0380
Description:
Target: scaffold0380; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 6159 - 6323
Alignment:
| Q |
64 |
gtaaactgatattgggtgcatcatttcaagtttgtaagccgaatttttctattctttcaaatttgtgtctcttcatattaactaatgcctcttatattta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6159 |
gtaaactgatattgggtgcatcatttcaagtttgtaagccgaatttttctattctttcaaatttgtgtctcttcatattaactaatgcctct--tattta |
6256 |
T |
 |
| Q |
164 |
cnnnnnnnnagaatcaatttcttttctataaagcatcgctgctgtttggtattgttcaagtataatc |
230 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6257 |
ctttttcttataatcaatttcttttctataaagcatcgctgctgtttggtattgttcaagtataatc |
6323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University