View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13809_low_13 (Length: 245)
Name: NF13809_low_13
Description: NF13809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13809_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 122 - 228
Target Start/End: Original strand, 37790967 - 37791073
Alignment:
| Q |
122 |
cattggtcgtgtaaaactattttacactccaatgaattcacactatgatgccactttttagactagtgcctaaagtttcttaacaaatatctattttatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37790967 |
cattggtcgtgtaaaactattttacactccaatgaattcacactgtggtgccactttttagactagtgcctaaagtttcttaacaaatatctatttgttg |
37791066 |
T |
 |
| Q |
222 |
taatttt |
228 |
Q |
| |
|
||||||| |
|
|
| T |
37791067 |
taatttt |
37791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University