View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_high_18 (Length: 370)
Name: NF1380_high_18
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 5534655 - 5534445
Alignment:
| Q |
14 |
gatgaagcacttgataatctttcatttcactcaattttaaggtgtggagattattaaa-tgatgatggtggttctcttaatttttggaggcatcgtattg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5534655 |
gatggagcacttgataatctttcatttcactcaattttaaggtgtggagattattaaaatgatgatggtggtcctcttaatttttggaggcatcgtattg |
5534556 |
T |
|
| Q |
113 |
ttctttatatctgaactgtgctgttgcatttaaccgagcaaagatagaatatcgatgtgctcgctctttgtggtgaatggaccattgagaacaaatccat |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5534555 |
ttctttatatctgaactgtgttgttgcatttaaccgagcaaagatagaatctcgatgtgctcgctctttgtggtgaatggaccattgagaacaaatccat |
5534456 |
T |
|
| Q |
213 |
ctactttgtcg |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
5534455 |
ctactttgtcg |
5534445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 122 - 160
Target Start/End: Complemental strand, 39395362 - 39395324
Alignment:
| Q |
122 |
tctgaactgtgctgttgcatttaaccgagcaaagataga |
160 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39395362 |
tctgaactgtgttgttgcatttaactgagcaaagataga |
39395324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University