View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_high_28 (Length: 325)
Name: NF1380_high_28
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 73 - 296
Target Start/End: Original strand, 33695599 - 33695823
Alignment:
| Q |
73 |
acgtctttaacacttacaaatgaaattataaaccagagacgaatttcattatgctatctctaatttccgttgaaaattcaacttgtttaacgccgtaaat |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33695599 |
acgtctttaacacttacaaatgaaattataaaccagagacgaatttcattatgctatctctaatttccgttgaaaattcaacttgtttaacgccgtaaat |
33695698 |
T |
 |
| Q |
173 |
ttttaaaacaagatgaattatcagcaaaaattaaagatagtagaatgaaattctcttagca-nnnnnnnnnnaatattctactaggaattatcattatca |
271 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
33695699 |
ttttaaaacaagatgaattatcagcataaattaaagatagtagaatgaaattctcttagcatttttttttttaatattctactaggaattatcattatta |
33695798 |
T |
 |
| Q |
272 |
cttacttctatatgcacctttaaca |
296 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33695799 |
cttacttctatatgcacctttaaca |
33695823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University