View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_high_34 (Length: 281)
Name: NF1380_high_34
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 113 - 253
Target Start/End: Original strand, 40518332 - 40518472
Alignment:
| Q |
113 |
aaataaccatcatactctttatagatcactttattgattattgaagatggtcttataacgtaagcgggatgacgtacatgtctttggccgtattatgaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518332 |
aaataaccatcatactctttatagatcactttattgattattgaagatggtcttataacgtaagcgggatgacgtacatgtctttggccgtattatgaat |
40518431 |
T |
 |
| Q |
213 |
ggataacatagaaggagtaaattcatgtaccataaattaat |
253 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40518432 |
ggataacatagacggagtaaattcatgtaccataaattaat |
40518472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 40518269 - 40518308
Alignment:
| Q |
14 |
aaatatatcctagttgaatacttatttgttattattatca |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518269 |
aaatatatcctagttgaatacttatttgttattattatca |
40518308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University