View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1380_high_34 (Length: 281)

Name: NF1380_high_34
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1380_high_34
NF1380_high_34
[»] chr3 (2 HSPs)
chr3 (113-253)||(40518332-40518472)
chr3 (14-53)||(40518269-40518308)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 113 - 253
Target Start/End: Original strand, 40518332 - 40518472
Alignment:
113 aaataaccatcatactctttatagatcactttattgattattgaagatggtcttataacgtaagcgggatgacgtacatgtctttggccgtattatgaat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40518332 aaataaccatcatactctttatagatcactttattgattattgaagatggtcttataacgtaagcgggatgacgtacatgtctttggccgtattatgaat 40518431  T
213 ggataacatagaaggagtaaattcatgtaccataaattaat 253  Q
    |||||||||||| ||||||||||||||||||||||||||||    
40518432 ggataacatagacggagtaaattcatgtaccataaattaat 40518472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 40518269 - 40518308
Alignment:
14 aaatatatcctagttgaatacttatttgttattattatca 53  Q
    ||||||||||||||||||||||||||||||||||||||||    
40518269 aaatatatcctagttgaatacttatttgttattattatca 40518308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University