View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1380_high_45 (Length: 251)

Name: NF1380_high_45
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1380_high_45
NF1380_high_45
[»] chr8 (1 HSPs)
chr8 (1-112)||(10233312-10233423)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 10233423 - 10233312
Alignment:
1 catgtgtttttcttttgtattctgtctataatcgttgtcgtaactgagtagcatatggttatatacctattttcaatagtttgcctaaagatgaccagac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
10233423 catgtgtttttcttttgtattctgtctataatcgttgtcgtaactgactagcatatggttatatacctattttcaatagtttgcctaaagatgaccagac 10233324  T
101 catgtctcagag 112  Q
     |||||| ||||    
10233323 tatgtcttagag 10233312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University