View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_high_52 (Length: 245)
Name: NF1380_high_52
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_high_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 30942854 - 30943093
Alignment:
| Q |
1 |
tttacttttagctaattaggtctatcaattttttatgcacataatggtttacaagaaatataaaatcttctatcaagaaatataaattctacaggatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942854 |
tttacttttagctaattaggtctatcaattttttatgcacataatggtttacaagaaatataaaatcttctatcaagaaatataaattctacaggatcag |
30942953 |
T |
 |
| Q |
101 |
agaccatcaaacatgttttctaaatagatgcatggac---nnnnnnnnngaaaatagatagacaaattacactagagaaacatgcacatcattttggtgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30942954 |
agaccatcaaacatgttttctaaatagatgcatggacaaaaaaaaaaaaaaaaattgatagacaaattacactagagaaacatacacatcattttggtgt |
30943053 |
T |
 |
| Q |
198 |
gtgcttttcaaaaaggaaattccaaaattgtctatgagaa |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30943054 |
gtgcttttcaaaaagggaattccaaaattgtctatgagaa |
30943093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University