View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1380_low_23 (Length: 366)

Name: NF1380_low_23
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1380_low_23
NF1380_low_23
[»] chr5 (1 HSPs)
chr5 (132-256)||(2660728-2660849)


Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 132 - 256
Target Start/End: Original strand, 2660728 - 2660849
Alignment:
132 tataccaaaacaccactccaatttcacttcactagggtagaatttcttatcttcttccttttctcacaaattcatcttttagatctaaattctttttcaa 231  Q
    |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||   |||||||||||||||||||||||||||||||||||||||||    
2660728 tataccaaaacaccactccaatttcacttcactacggtagagtttcttatcttctt---tttctcacaaattcatcttttagatctaaattctttttcaa 2660824  T
232 aattatttaacccacctggtcggtc 256  Q
    |||||||||||||||||||||||||    
2660825 aattatttaacccacctggtcggtc 2660849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University