View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_low_40 (Length: 294)
Name: NF1380_low_40
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 132 - 256
Target Start/End: Original strand, 2660728 - 2660849
Alignment:
| Q |
132 |
tataccaaaacaccactccaatttcacttcactagggtagaatttcttatcttcttccttttctcacaaattcatcttttagatctaaattctttttcaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2660728 |
tataccaaaacaccactccaatttcacttcactacggtagagtttcttatcttctt---tttctcacaaattcatcttttagatctaaattctttttcaa |
2660824 |
T |
|
| Q |
232 |
aattatttaacccacctggtcggtc |
256 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2660825 |
aattatttaacccacctggtcggtc |
2660849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University