View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_low_55 (Length: 251)
Name: NF1380_low_55
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 120 - 199
Target Start/End: Complemental strand, 23766428 - 23766349
Alignment:
| Q |
120 |
gcacaaaaatatatatcttgatagatttcggacctcgatcattttgtaacnnnnnnncgaaaacaactcgatcattattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23766428 |
gcacaaaaatatatatcttgatagatttcgaacctcgatcattttgtaacaaaaaaacgaaaacaactcgatcattattt |
23766349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 23766334 - 23766281
Alignment:
| Q |
184 |
aactcgatcattatttttgttaaccctcgtatataagttcttataatttggagt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23766334 |
aactcgatcattatttttgttaaccctcgtatataagttcttataatttggagt |
23766281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University