View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_low_61 (Length: 244)
Name: NF1380_low_61
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 37110108 - 37110327
Alignment:
| Q |
1 |
acaataacataatgcatgtatttgaggaattaaactgttcatgtaatgattgtttcaagtacaaacatatagtaattcttaaagaaacagcttgcacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37110108 |
acaataacataatgcatgtatttgaggaattaaacttttcgtgtaaggattgtttcaagtacaaacatatagtaattcttaaagaaacagcttgcacaac |
37110207 |
T |
 |
| Q |
101 |
acaaaactcaagctgtagcaacaaattcctgtcctgacttttttgcataacacaaacttaatttgatggcataatttcaatttttatggcagtgtattgc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37110208 |
acaa--ctcaagctgtagcaacaaattcctgtcctgacttttttgcataacacaaacttaatttgatggcataatttcaatttttatggcagtgtattgc |
37110305 |
T |
 |
| Q |
201 |
attaaattcagacgtagacatg |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
37110306 |
attaagttcagacgtagacatg |
37110327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University