View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1380_low_62 (Length: 228)
Name: NF1380_low_62
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1380_low_62 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 41468152 - 41468379
Alignment:
| Q |
1 |
agagtgagagtaacgagtccaaccaagttcagtgagtcgttgctcaagttgagagaaggaatgaatgacttggtttgttggaagatatacaagaattctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41468152 |
agagtgagagtaacgagtccaaccaagttcagtgagtcgttgctcaagttgagagaaggaatgaatgacttggtttgttggaagatatacaagaactctt |
41468251 |
T |
 |
| Q |
101 |
ggtcttgcacctggtgctgttgctgttcctgttcctggttctgtcttgtgctcaaaggattctcttgttgggttggttattaacctcaccacacctttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468252 |
ggtcttgcacctggtgctgttgctgttcctgttcctggttctgtcttgtgctcgaaggattctcttgttgggttggttattaacctcaccacacctttct |
41468351 |
T |
 |
| Q |
201 |
tgtcaaatacccatacacctgacattac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41468352 |
tgtcaaatacccatacacctgacattac |
41468379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University